Genomes to Natural Products Network (GNPN):
Stanford Genome Technology Center


image

The 50:50 Method for Genome Modification in Yeast

Method Overview

50:50 is a PCR method based on the original 2-step (pop-in/pop-out) gene replacement method of Scherer and Davis (1979). 50:50 requires only two primers, one PCR, and one yeast transformation. The key is the forward primer, the 50:50 primer. It contains 50 nts genomic homology upstream of the modification, the modification itself, 50 nts genomic sequence downstream of the modification, and 18 nts (U2 sequence) to prime URA3 PCR. The reverse primer is of standard design, with 50 nts reverse complement of genomic sequences downstream of the alteration and 19 nts (D2 sequence) to prime URA3 PCR.

When transformed into yeast and selecting for URA3, the 50:50 cassette integrates (pops-in) at the target locus via the short genomic homology regions on each end. This is a fairly stable integration, but pop-out recombinants do occur at a frequency of about 10-7 between the 50 nt sequence downstream of the modification on the 50:50 primer and the homologous 50 nt sequence on the reverse primer. This recombination results in pop-out of URA3 and leaves only the intended modification.

Some PCR polymerases have a problem amplifying the 50:50 PCR cassette because it has a 50 bp direct repeat flanking URA3. We routinely use Takara ExTaq with good success. If you encounter trouble using another polymerase, we provide a protocol and primer sequences for a split URA3 PCR that remedies the problem.

We recommend using pJH136 with its flanking U2 and D2 priming sites. But any URA3 DNA should work for making a 50:50 PCR cassette for transformation. Note that the 50:50 method only works in haploids and only on non-essential genes. We order primers from Operon, with a present length limit of 125 nts. This limits the altered DNA in the 50:50 primer to be 0 to 7 nts. Decreasing the length on the very ends of the genomic homology would allow space for a longer altered sequence.


Materials:

Takara ExTaq DNA polymerase (Clontech, Cat. # RR001A)
Plasmid pJH136. URA3 PCR template for making 50:50 cassettes for transformation.
Flanking U2 and D2 priming sites provide robust amplification.
 Plasmid, map, and full sequence available from Addgene (plasmid #47554).
U2 primer: CGTACGCTGCAGGTCGAC
D2 primer: ATCGATGAATTCGAGCTCG
URA3.for: CACAGTTAAGCCGCTAAAGGC
URA3.rev: AGTATATTCTCCAGTAGCTAGGGAGCC
Custom 50:50 primer: 50 nts upstream of genomic alteration site + alteration (0-7 nts) + 50 nts downstream of alteration + 18 nts U2 sequence.
Custom reverse primer: reverse complement of 50 nts downstream of genomic alteration site + 19 nts D2 sequence

Protocol

50:50 Cassette PCR using Takara ExTaq

55 µl reaction volume
5.5 µL 10X ExTaq buffer
4.4 µL NTP mix (2.5 mM each, provided with kit)
0.28 µL ExTaq enzyme (5 U/µL)
2.75 µL each primer (5 µM stock)
3.3 µL pJH136 or other URA3 template plasmid (10 ng/µL stock)
water to 55 µL total

Cycling conditions

94C, 1 min
35 cycles @

|98C, 10 sec
|55C, 30 sec
|72C 1.5 min (1 min/kb)

72C, 2 min
4C, hold

Following PCR, check 5 µL on a gel. Expect a major 1.3 kb band if using pJH136.
Transform 45 µL PCR into yeast, either with a straight PCR transformation protocol or after concentrating by ethanol precipitation or spin column.

Yeast transformation, pop-in of the 50:50 cassette and pop-out of URA3

Transform a ura3? haploid strain with the 50:50 PCR cassette made above, using a lithium acetate protocol. After the final step when the PEG solution is removed from the yeast pellet, resuspend the cells in 500 µL sterile water. Use a new tube to dilute 5-fold by mixing 100 µL cells with 400 µL water. Spread 300 µL of each cell suspension to SC-Ura plates (synthetic dextrose complete medium lacking uracil). Incubate at 30C for two days. As with most transformations with PCR products, there is a background lawn that appears. After two days, replica plate to fresh SC-Ura plates. A day later, nice colonies should appear with little or no background lawn. The 1/5 diluted plate is usually the best plate to pick transformants from.

Choose several well isolated colonies from the replica plate and perform colony PCR. Use internal URA3 primers and target locus primers that hybridize about 300 bp up and down of the 50:50 cassette integration site. Thus, one PCR will be genomic forward primer + URA3.rev primer, and the other will be URA3.for primer + genomic reverse primer.

Streak purify several correct integrants on YPD to obtain single, well-isolated colonies. Use colonies to inoculate 3 mL broth for non-selective growth to allow pop-outs. YPEG (2.5% ethanol and 2% glycerol) is recommended to prevent growth of petites, but YPD should be okay. Grow cells to saturation (~2x108 cells/mL) by shaking at 30C overnight (YPD) or for 2 days (YPEG). Plate 50 µL cells mixed with 250 µL water to a plate of synthetic complete medium containing 0.8 mg/mL FOA (US Biological). Incubate plates at 30C for 2-3 days. Expect 30 to up to 200 colonies. Identify correct pop-outs by colony PCR and DNA sequencing.

Split URA3 PCR protocol to be used if the 50 bp repeats cause problems with cassette PCR

In this protocol, you will set up two PCRs: one will be for the 50:50 primer and the 5’ portion of URA3, and the other will be the 3’ portion of URA3 and the reverse primer. These two PCRs separate the 50 bp repeats present on the primers into two reactions. The URA3 fragments share a 280 bp overlap, which can recombine during co-transformation to restore an intact URA3 marker and full 50:50 cassette.

Set up two PCRs as described above, with the following changes:

Use Takara ExTaq or your favorite PCR polymerase and associated reagents. Set up two 30 µL PCRs.
PCR 1 will be 50:50 primer + URA3.rev
PCR 2 will be URA3.for + genomic reverse primer
Adjust cycling conditions to match the shorter products (866 bp for PCR1, 735 bp for PCR2, if using pJH136) and your particular PCR polymerase.
Check 5 µL each PCR on a gel.
Mix 22.5 µL each PCR and use to transform yeast, either with a straight PCR transformation protocol or after concentrating by ethanol precipitation or spin column.

References

  1. Horecka J, Davis RW. The 50:50 method for PCR-based seamless genome editing in yeast. Yeast. 2014 31:103-112. PMCID: PMC3960506.
  2. Scherer S, Davis RW. Replacement of chromosome segments with altered DNA sequences constructed in vitro. Proc Natl Acad Sci U S A. 1979 76: 4951–4955. PMCID: PMC413056.

 



Inquiries can be addressed to Maureen Hillenmeyer (maureenh at stanford.edu) and Angela Chu (amchu at stanford.edu)
Stanford Genome Technology Center