Genomes to Natural Products Network (GNPN):
Stanford Genome Technology Center


Barcode quantification by Illumina Sequencing

Method Overview

The following steps describe quantification of DNA barcodes using next-generation sequencing (Smith et al. 2009; Smith et al. 2010; Gresham et al. 2011; Robinson et al. 2013).

Materials:

Protocol

  1. PCR amplify UP and DN tags from each sample in separate reactions using primers containing: Illumina adapters, short index barcodes for sample multiplexing, and the common priming sites for each tag (see PCR reaction mixture under recipes). PCR conditions are as follows:

  2. i. 94°C for 3 minutes

    ii. 94°C for 30 seconds
    iii. 55°C for 30 seconds
    iv. 72°C for 30 seconds
    --> go to step ii. 29 times

    v. 72°C for 3 minutes

    vi. 4°C hold


  3. 2. Verify the PCR reactions were successful by applying gel electrophoresis to a small aliquot of each reaction (each PCR reaction is expected to yield 144 bp and 147 bp fragments for UP and DN tags, respectively). PCR products can be stored at -20°C for 3 months.

  4. Purify the PCR amplicons by adding 50 µl of AMPure XP beads to 30 µL of each PCR reaction, incubate for 5 min at room temperature, and collect the beads using a magnetic rack.

  5. Remove the supernatant and wash the beads twice with 200 µL of freshly prepared 70% ethanol while keeping the tubes in the magnetic rack.

  6. Aspirate the supernatant and let the beads dry for 5 minutes.

  7. Remove tubes from the magnetic rack, elute the DNA in 30 µL of de-ionized water, then reapply magnetic force to collect the beads, and transfer supernatant to a fresh tube.

  8. (Optional) Analyze the size and concentration of the purified PCR amplicons using a highly sensitive electrophoretic system (such as the Bioanalyzer 2100 instrument). Samples can also be quantified with fluorescent DNA-binding dye approaches (such as the Qubit fluorometric system).

  9. Dilute a small aliquot of each DNA sample 1:50,000 and 1:100,000 with KAPA Library Quantification kit dilution buffer and then quantify the concentration of every sample using the KAPA Library Quantification kit and a real-time PCR system (such as the Applied Biosystems 7900HT instrument).

  10. Mix the 12 DNA samples so that the final concentration of the resulting sequencing library is 1 nM and every sample is represented in equimolar amounts.

  11. Thaw the ready-to-use reagent cartridge (containing reagents and buffer HT1) of an Illumina MiSeq Reagent kit for 30 minutes in de-ionized water.

  12. Combine 10 L of the sequencing library with 10 L of 0.2 N NaOH (freshly diluted from a 2 N solution) and incubate for 5 minutes at room temperature.

  13. Add 980 µL of pre-chilled HT1 buffer to the denatured sequencing library, vortex, and place on ice. The concentration of the library is now 10 pM.

  14. Dilute the PhiX control stock solution to 2 nM in water, then combine 10 µL of this diluted PhiX control solution with 10 µL of 0.2 N NaOH and incubate for 5 min at room temperature.

  15. Add 980 µL of pre-chilled HT1 buffer to the denatured PhiX control, vortex, and place on ice. The concentration of the PhiX control is now 20 pM and can be stored at -20°C for 3 weeks.

  16. Combine 225 µL of the denatured and diluted sequencing library (from step 12) with 12.5 µL PhiX control (from step 14) and 762.5 µL HT1 buffer. The final concentrations of the sequencing library and PhiX control are 2.25 pM and 0.25 pM, respectively.  

  17. Inject 600 µL of this mixture into the cartridge of the Illumina MiSeq Reagent kit and start the sequencing run on the MiSeq instrument.

Recipes

PCR Reaction Mixture

(Final Concentration of 1X reaction buffer: 1mM MgCl2, 0.08 mM dNTPs, 0.1 M each UP-X and UP-KANMX oligonucleotides, 0.05 U/L)

Prepare 50 µL ‘UP tag’ PCR Reaction Mix for each sample as follows:

5 µL of 10X reaction buffer
2 µL of 25 mM MgCl2
0.4 µL of 10 mM dNTPs
0.5 µL of 10 µM UP-X oligonucleotide(see table below)
0.5 µL of 10 µM UP-KANMX oligonucleotide(see table below)
0.5 µL of 5 U/µL Taq polymerase
~75 ng of purified genomic DNA
De-ionized water to 50 µL

PCR-amplify the ‘DOWN tags’ in the same way, but use DN-X oligonucleotide and DN-KANX oligonucleotide in place of UP-X and UP-KANMX, respectively.


Primer Sequences (6 base indexes in bold)


Oligonucleotide Sequence (5’ to 3’)
UP-KanMX CAAGCAGAAGACGGCATACGAGATGTCGACCTGCAGCGTACG
UP-1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGCTAAGATGTCCACGAGGTCTCT
UP-2 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGTCAGATGTCCACGAGGTCTCT
UP-3 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGGATTAGATGTCCACGAGGTCTCT
UP-4 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCGTTGAGATGTCCACGAGGTCTCT
UP-5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGATCGATGTCCACGAGGTCTCT
UP-6 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCTTAACGATGTCCACGAGGTCTCT
DN-kanMX CAAGCAGAAGACGGCATACGAGATGAAAACGAGCTCGAATTCATCG
DN-1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCCCGACGGTGTCGGTCTCGTAG
DN-2 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAAACCTCGGTGTCGGTCTCGTAG
DN-3 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCTGACTCGGTGTCGGTCTCGTAG
DN-4 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCGGACGGTGTCGGTCTCGTAG
DN-4 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGTAGCGGTGTCGGTCTCGTAG
DN-6 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGAGGACGGTGTCGGTCTCGTAG

 

References.

  1. Smith AM, Durbic T, Kittanakom S, Giaever G, Nislow C. 2012. Barcode sequencing for understanding drug-gene interactions. Methods Mol Biol 910: 55-69. PMID: 22821592
  2. Smith AM, Heisler LE, Mellor J, Kaper F, Thompson MJ, Chee M, Roth FP, Giaever G, Nislow C. 2009. Quantitative phenotyping via deep barcode sequencing. Genome Res 19: 1836-1842. PMCID: PMC2765281
  3. Robinson DG, Chen W, Storey JD, Gresham D. 2013. Design and Analysis of Bar-seq Experiments. G3 (Bethesda). PMCID: PMC3887526
  4. Gresham D, Boer VM, Caudy A, Ziv N, Brandt NJ, Storey JD, Botstein D. 2011. System-level analysis of genes and functions affecting survival during nutrient starvation in Saccharomyces cerevisiae. Genetics 187: 299-317. PMCID: PMC3018308

     



Inquiries can be addressed to Maureen Hillenmeyer (maureenh at stanford.edu) and Angela Chu (amchu at stanford.edu)
Stanford Genome Technology Center